Construction of Caries DNA Vaccine pCDNA-ComD
Endang Winiati Bachtiar, Boy M Bachtiar,
¼Ò¼Ó »ó¼¼Á¤º¸
( Endang Winiati Bachtiar ) - Universitas Indonesia Faculty of Dentistry Departments of Oral Biology
( Boy M Bachtiar ) - Universitas Indonesia Faculty of Dentistry Departments of Oral Biology
KMID : 1157520150110030137
Abstract
Objective: The aim of the study is to construct anti-caries DNA vaccine harboring a main virulence genes from caries pathogen Streptococcus mutans.
Methods: The gene encoding a quorum sensing molecule (ComD) was amplified from genomic DNA from S. mutans by polymerase chain reaction (PCR), using primers: ComD-F: 5¡¯ggatccatgaatgaagccttaatgat 3¡¯ and ComD-R: 5¡¯ ggatcctattttattattag-gagttgc 3¡¯. Then the PCR product was digested with BamH1 and cloned into the plasmid pCDNA3.1 containing CMV promoter and ampicillin resistant gene that had been digested with the same enzyme. The plasmid was then transformed into Escherichia coli JM 2163, and plasmid DNA was subsequently isolated from this strain. Passaging of plasmid DNA via JM 2163 ensures stability of plasmid DNA. Finally the recombinant plasmid pCDNA-ComD was analyzed by DNA sequencing and for protein ComD expression from transfected HaCat cell line by Western blotting.
Results: The S. mutans ComD gene was successfully cloned into the pCDNA3.1 vector and PCR confirmed that the new clone, pCDNA-ComD consists of a 1.3 kb of ComD DNA fragment. Sequence analysis of the ComD coding region in pCDNA-ComD revealed an identity match of 100% with that of ComD DNA sequences from the Gene Bank database. In addition, Western blot showed the expression of ComD protein from transfected HaCat cell line.
Conclusion: We have successfully constructed anti caries DNA vaccine pCDNA-ComD.
Å°¿öµå
Streptococcus mutans; vaccines; DNA; dental caries; quorum sensing; biofilms
¿ø¹® ¹× ¸µÅ©¾Æ¿ô Á¤º¸
µîÀçÀú³Î Á¤º¸